Anaplastic Oligodendroglioma

(S)-perillyl alcohol temozolomide, 1,2:5,6-Dianhydrogalactitol, 18-(p-[124I]-iodophenyl)octadecyl phosphocholine, 2-hydroxyoleic acid, 4,6,8-trihydroxy-10-(3,7,11-trimethyldodeca-2,6,10-trienyl)-5,10-dihydrodibenzo[b,e][1,4] diazepin-11-one, 4-[123I] iodo-L-phenylalanine, 4-[131I] iodo-L-phenylalanine, 5-aminolevulinic acid hydrochloride ( GLEOLAN, GLIOLAN ), 7-beta-hydroxycholesteryl-3-beta-oleate, Adenoviral vector serotype 5 encoding the human interleukin-12 p70 transgene, Adenovirus serotype 5 containing partial E1A deletion and an integrin-binding domain, Adenovirus-associated vector containing human Fas-c gene, Adenovirus-mediated Herpes Simplex Virus-thymidine kinase (HKSV-tk) gene ( CEREPRO ), Allogeneic and autologous haptenised and irradiated cells and cell lysates derived from glioma, Asunercept, Autologous Tumor-Derived gp96 Heat Shock Protein-Peptide Complex ( ONCOPHAGE ), Autologous dendritic cells pulsed with RNA from glioma stem cells, Autologous dendritic cells pulsed with autologous cell lysate, Autologous dendritic cells pulsed with tumour antigen-derived synthetic peptides (MAGE-1, HER-2, AIM-2, TRP-2, gp-100, and interleukin-13 receptor alpha), Autologous ex-vivo-expanded leucocytes treated with 5-aza-2'-deoxycytidine, Autologous glioma tumour cells treated with antisense molecule directed against the insulin-like growth factor type 1 receptor, Bevacizumab ( Equidacent, AVASTIN, Aybintio, MVASI ), Biotinylated anti-tenascin monoclonal antibody for use with 90-Yttrium, Boswellia serrata resin dry extract, Cannabidiol ( EPIDIOLEX, EPIDYOLEX ), Carmustine ( GLIADEL, BICNU, CARMUSTINE OBVIUS ), Carmustine (solution for intratumoral injection), Cilengitide, Combination of carboplatin and sodium valproate, Delta-9-tetrahydrocannabinol and cannabidiol from extracts of the Cannabis sativa L. plant, Doxorubicin (administered after synthetic double-stranded siRNA oligonucleotide directed against claudin-5 complexed with polyethyleneimine), Doxorubicin hydrochloride (drug eluting beads), Dronabinol and cannabidiol, Eflornithine, Enzastaurin hydrochloride, Erlotinib hydrochloride ( TARCEVA ), Florilglutamic acid (18F), Fluciclovine (18F), Flucytosine ( ANCOTIL ), Gadodiamide (liposomal), Galunisertib, Gimatecan, Glutathione-pegylated liposomal doxorubicin hydrochloride, H-Arg-Pro-Lys-Pro-Gln-Gln-Phe-2Thi-Gly-Leu-Met(O2)-NH2-DOTA-213-bismuth, H-Arg-Pro-Lys-Pro-Gln-Gln-Phe-2Thi-Gly-Leu-Met(O2)-NH2-DOTA-225-Actinium, Herpes simplex virus lacking infected cell protein 34.5, Human transferrin conjugated to mutant diphtheria toxin, Humanised monoclonal antibody against epidermal growth factor receptor, Humanised recombinant monoclonal antibody against epidermal growth factor receptor conjugated to maleimidocaproyl monomethylauristatin F, IL-12-secreting dendritic cells, loaded with autologous tumour lysate, Iodine (131I) anti-nucleohistone H1 chimeric biotinylated monoclonal antibody, Iodine (131I) anti-tenascin monoclonal antibody 81C6, Iodine (131I) chlorotoxin, Irinotecan hydrochloride (drug eluting beads), L-cysteine, L-leucyl-L-alpha-glutamyl-L-alpha-glutamyl-L-lysyl-L-lysylglycyl-L-asparaginyl-L-tyrosyl-L-valyl-L-valyl-L-threonyl-L-alpha-aspartyl-L-histidyl-S-[1-[(4-carboxycyclohexyl)methyl]-2,5-dioxo-3-pyrrolidinyl]-complex with keyhole limpet haemocyanin, Larotrectinib ( VITRAKVI ), Marizomib, N-(4-Methoxyphenyl)-N,2,6-trimethylfuro[2,3-d]pyrimidin-4-amine, Nimotuzumab ( THERALOC ), Oligonucleotide phosphorothioate (TAAACGTTATAACGTTATGACGTCAT), Onfekafusp alfa, Paclitaxel-succinate-Arg-Arg-Leu-Ser-Tyr-Ser-Arg-Arg-Arg-Phe, Picropodophyllin, Pritumumab, Pseudomonas exotoxin (domains II/III)-Interleukin 13 chimeric protein, Recombinant fusion protein of circulary-permuted IL-4 and pseudomonas exotoxin A, [IL-4(38-37)-PE38KDEL], Recombinant human bone morphogenetic protein 4, Regorafenib ( STIVARGA ), Salmonella typhi Ty21a strain transfected with a plasmid vector encoding the human vascular endothelial growth factor receptor 2, Synthetic double-stranded siRNA oligonucleotide directed against claudin-5 complexed with polyethyleneimine (prior to administration of doxorubicin), Talampanel, Technetium (99mTc) tetrofosmin, Temozolomide ( TEMODAL, TEMODAR ), Topotecan hydrochloride (liposomal), Trabedersen, Tranilast, Veledimex, Vocimagene amiretrorepvec, Zoledronic acid, Zotiraciclib